Materialization of DNA molecules

Phantom another being and materialization of DNA molecules. Experiments.

Winner of the Nobele Award 2008., for their discovery of human immunodeficiency virus, Luc Montagnier and sponsors (Jamal Aissa, Claude Lavallee, Luc Montagnier ) patented method “teleportation” DNA www.google.com/patents/WO2012142568A2?cl = en , then, l. Montagnier published a article about this http://www.rexresearch.com/montagnier/montagnier.pdf

This work has caused a stormy, mostly negative, reactions in the scientific world, as it turns our perceptions of the roles of DNA and confronts the task of explaining this phenomenon physicists. The method is complicated and not actually Montagnier discovered in detail.

We have developed a much more simple and easily reproducible method of quantum transmission of copies of DNA based on laser technology, that is confirmed by PCR.
Publishing perspectives working genes on the basis of such technology are vast. First of all, This programming stem cells. This gives a real opportunity to regenerate the retina – return the vision (the precedent of this we have created), regenerate teeth (the precedent of this we have created), generally all the organs and tissues, endocrine glands, to eliminate damage to the spinal cord and brain (the precedent of this we have created), shoot the chromosomal damage, for example, in cystic fibrosis (the precedent of this we have created), turn off the extra chromosome in down's syndrome (the precedent of this we have created), treat the terminal stage of cancer (We have done). And much more. This is potentially a huge business.

Further work in this direction will yield even more powerful impetus to the development of biology, biokomp′ûtingu, medicine, Agriculture, biointernetu, deep space communications, etc. d. We have published some theoretical analysis of this phenomenon, We actually received long before the work of l. Montagnier — based on the example of quantum transmission running complex genes to regenerate the pancreas in rats [Garyaev P., Kokaya A., Mukhina I., Leonova-Garyaeva E., Кокая Н. Г., 2007, Effect of modulated electromagnetic radiation on biostrukturami for alloksanovogo of diabetes mellitus in rats. Бюллетень Эксп. Биол. и Мед., # 2, с. 155-158], http://vixra.org/pdf/1111.0107v1.pdf , http://dnadecipher.com/index.php/ddj/article/view/4 , http://www.tgdtheory.fi/curri.html L.Montane group experiments nobody played, because the key points method not revealed even in the patent.

Now it is time to reproduce the experiments of Luc Montagnier, but in a different way, using our laser technology. We have implemented this. Significantly, It was discovered by a whole new set of phenomena, accompanying the "teleportation" quantum equivalent of DNA in water. Deliberately giving these primary results without parts and without discussion. Early. Main, What we have also demonstrated the possibility of PCR DNA synthesis on a purely aqueous matrix, which recorded the wave equivalent of DNA in the form of a DNA fragment of the modulated wideband electromagnetic field (MBER). This is a secondary electromagnetic field used by us laser. The theory of education of secondary field is given in our article [I.v. Prangishvili, P.P. Garyaev, G.g. Dmitri Tertyshny, Vladimir Maksimenko, A.v. Mologin, E. Leonova, E.r. Ernest. Sensors and systems, # 9 (18), c. 2-13 (2000g.) SPECTROSCOPY OF LOCALIZED RADIATION PHOTON-WAVE: ACCESS TO NON-LOCAL QUANTUM BIO-INFORMATIONAL PROCESSES].
But, Once again, did we not, How did a group of Luc Montagnier.

Here is the result of our experiments on the synthesis of DNA fragment in his Phantom. Let Me Remind you, DNA phantoms I managed to detect and register in 1984. Details in monograph Gariaev P.p., 2009g., «Lingvistiko-wave gene. Theory and practice ". Kiev. 220s.

Methods for Amplification. Phantom 547 bp long DNA. with Polymerase Chain Reaction (PCR) Using Modulated Secondary Broadband Electromagnetic Radiation (MBER) of LGN-303 Laser as a Quantum Equivalent of Analogous Material DNA .

[button link=”https://drive.google.com/file/d/0B1FRa04zGG6iVmF4Z2NZUEdKQUk/view?usp=sharing” text=”experiment 1″] [button link=”https://drive.google.com/file/d/0B1FRa04zGG6ibVY3emVEV21wbDA/view?usp=sharing” text=”experiment 2″]

 

For a complete description of the method of detection and materialization of phantoms DNA PCR System.

Step 1. Getting the original DNA product
The PCR product of 547 bp was taken as a starting DNA product, for the receipt of which used a cloned in plazmidnom vector synthetic sequence.
Plus a chain of DNA:
5′-CCTTACGTCAGTGGAGATGTCACATCAATCAACTTGCTTTGAAGACGTGGTTGGAA CGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAATGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCTACTGTCCTTGCGCGCTATATTTTGTTTTCTATCGCGTATTAAATGTATAATTGGGGGACTCTAATCATAAAAACCCATCTCATAAATAACGTCATGCATTACATGTTAATTATTACATGCTTAACGTAATTCAACAGAAATTATATGATAATCATCGCAAGACCGGCAACAGGATTCAATCTTAAGAAACTTTATTGCACGCATTAATGGACTGGATTGGGGCCAACTCCTACCGTACCTGGCATTACCCTTACGCTGAAGAGATGCTCGACTGGGCAGATGAACATGGCATCGTGGTGATTGATGAAACTGCTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTGGAAGCGGGCA-3′